Mahak Garg^1,2, Gaurav Sharma², Harman Preet Singh Kapoor³, Inusha Panigrahi^4*

¹Department of Pediatrics, Postgraduate Institute of Medical Education and Research, Chandigarh India

²Department of Translational and Regenerative Medicine, Postgraduate Institute of Medical Education and Research, Chandigarh India

³Department of Statistics, Central University of Punjab, Bathinda, India

⁴Professor and Unit Head, Genetic Metabolic unit, Department of Pediatrics, APC, PGIMER, Chandigarh, India. ORCID ID: 0000-0001-7375- 9892

*Corresponding Author: Inusha Panigrahi, Professor and Unit Head, Genetic Metabolic unit, Department of Pediatrics, APC, PGIMER, Chandigarh, India. ORCID ID: 0000-0001-7375-9892

Abstract
Down Syndrome (DS) is the most prevalent trisomy, linked to a higher risk of thromboembolic events, such as stroke, especially among those with congenital heart defects (CHD). Factor V Leiden (FVL) is a functional variant (F5:c.G1691A, rs6025) which is associated with increased thromboembolic complications. In the present study, we investigated the prevalence of this variant in DS patients with or without CHD. A total of 75 DS patients and 30 age- and sex-matched healthy controls were assessed for this variant using Sanger sequencing. Interestingly FVL frequency was higher in DS patients than in controls. In stratified analysis, this variant was overrepresented in DS patients with CHD at both phenotypic (p=0.037) and allelic (p=0.013) levels suggesting a possibly significant role in this subgroup which needs to be further explored.

Keywords: Down syndrome, Congenital Heart Defect, FVL, Sanger sequencing

1. Introduction
Down syndrome (DS) is the most common trisomy, primarily caused by an extra copy of chromosome 21. It occurs in approximately 1 in 800–1,000 live births, with higher maternal age being a significant risk factor [1, 2]. Clinically, DS individuals presents distinct physical features and predisposed to complications like intellectual disability, Congenital Heart Defects (CHD), and various health conditions, including elevated risk of stroke, and Moyamoya disease. Additionally, a higher incidence of thrombosis is observed among DS patients than in healthy controls in various studies (Supplementary Table 1).

Factor V Leiden (FVL) is a mutation involving a G1691A nucleotide substitution, first identified by a Dutch scientist in Leiden. This missense variant leads to an amino acid substitution from (Arginine) R to(Glutamine) Q at position 506, resulting in a reduced anticoagulant response to activated protein C (APC) leading to a pro thrombotic state (Figure 1). Various studies have linked FVL with different thromboembolic complications like Venous thromboembolism (VTE), stroke, pulmonary embolism, Moya moya syndrome, Deep vein thrombosis [3-7]. Since FVL is associated with thrombotic conditions, understanding its relationship with DS— where stroke, thrombosis, and Moyamoya syndrome are already prevalent—could provide valuable genetic insights and inform medical management tailored to DS patients. This study’s aim is to explore if any association exists between the FVL variant and CHD in DS patients. CHD is a common comorbidity in DS, with an incidence of 54–66% in DS infants [8]. CHD frequently involves the shunting of systemic blood to the pulmonary circulation, potentially leading to thromboembolic complications [9-13]. Therefore, this study was designed to analyze the prevalence of this variant in DS children with and without CHD. The findings could have important implications for improving early screening, preventive strategies, and personalized management in DS patients with CHD.

Figure 1: Mechanism of Action of Factor V Leiden (FVL).

(A) 1. Factor V is cleaved by thrombin at specific arginine residues (R709, R1018, and R1545) in the B domain, resulting in the formation of activated Factor Va. This complex along with Factor Xa, forms the prothrombinase complex, which facilitates the conversion of prothrombin to thrombin. Thrombin subsequently catalyzes the transformation of fibrinogen into fibrin, which polymerizes to form a blood clot. 2 Activated Protein C (APC) inactivates Factor Va by cleaving it at R306 and R506, producing inactivated Factor V (Factor Vi), which cannot convert prothrombin to thrombin, reducing clot formation. 3. FVL mutation provides resistance to APC-mediated inactivation, leading to a prolonged half- life of Factor Va in plasma and increased thrombin generation, and a heightened risk of thrombophilia.

(B) (i) In some cases, APC cleaves Factor V at R506 before thrombin, producing Factor Vac, which acts as an anticoagulant by aiding APC in the inactivation of Factor VIIIa. (ii)The FVL mutation disrupts this process, reducing Factor Vac's anticoagulant activity.

The FVL mutation promotes thrombosis through two mechanisms: a gain of function that enhances fibrin formation and a loss of anticoagulant activity by impairing Factor Vac’s role in Factor VIIIa inactivation.

2. Material and Methods
Seventy-five DS patients and thirty age-and-sex-matched healthy control children were enrolled from Genetic Clinic of PGIMER (Table 1). This study was approved by Institutional Ethics Committee (IEC) (NK/7949/PhD/784) and followed ICMR ethical guidelines. Informed consent was taken from the parents in line with the Declaration of Helsinki.

Table 1: Basic clinical features in DS children enrolled in the present study

SD: Standard Deviation; CHD: Congenital Heart Defect: FVL: Factor V Leiden

Sample Collection:
From December 2020 to July 2023, 2-3 ml of venous blood was collected from each participant in EDTA vacutainers. DNA was extracted using Qiagen kits and assessed both qualitatively and quantitatively using 0.8% agarose gel and a Nanodrop. Primers were designed using Primer Blast: Forward: 
CCCACAGAAAATGATGCCCAG; and Reverse TCTCCTGGCTAAATAATGGGGC (Primer Blast) for Sanger sequencing for analyzing the FVL variant with the help of Finch TV software. Direct counting was used for calculating allelic and phenotypic frequency. Statistical comparisons were done using Fisher’s Exact test with a significance determined at p< 0.05.

3. Results
Among the 75 DS patients, the FVL variant was identified in 8 individuals (Figure 2), while 67 displayed only the wild-type allele. None of the healthy controls exhibited the FVL variant. Although a higher frequency of the FVL variant was observed in DS patients compared to controls, this was not statistically significant at the phenotypic (p-value = 0.101) or allelic level (p-value = 0.110). Moreover, none of the study participants exhibited an FVL variant in the homozygous state, which is in concordance with population data of this variant from the Indian subcontinent ( Supplementary Table 2).

Figure 2: Sanger sequencing chromatogram of the F5 variant (FVL) in DS patients, with the variant position marked by a dark circle

Data from gnomAD database (Figure 3) revealed the highest allelic frequency of FVL variant in the Amish population (0.093), and the lowest in East Asians (0.00006) [14]. In our study, the allelic frequency was 0.053 in DS patients, which is higher compared to all general populations except the Amish.

Figure 3: Global distribution of the FVL variant allelic frequency across different populations. The highest FVL frequency is observed in the Amish population in the United States (0.093), while the lowest frequency is noted in the East Asian population (0.00006). Other frequencies include 0.02 in Europeans, 0.013 in South Asians, 0.003 in Africans, and a 0.037 in the Middle Eastern population. This map illustrates the variation in FVL prevalence worldwide, highlighting an elevated frequency in the DS children of this study (0.053), which surpasses the FVL frequencies observed in most populations represented here.

The association between different subgroups of individuals with DS and FVL was examined by categorizing DS individuals based on various comorbidities. In our stratified analysis, 7 out of 44 DS patients (15.9%) with CHD had the FVL variant, while it was absent in healthy controls (p=0.037, Figure 4). On the other hand, no association was observed between hypothyroidism and FVL in DS patients as well as compared to healthy controls. Conversely, a significant association was found between FVL and congenital heart disease (CHD) alone, as well as the combined presence of CHD and hypothyroidism in DS patients (p-value < 0.05) (Table 2). Thus there a positive association between FVL and CHD in DS children.

Figure 4: Distribution of FVL variation phenotypic and allelic frequency among controls and children with DS with and without CHD. FVL negative (FVL-) individuals are shown in green, FVL positive (FVL+) individuals are shown in red. Statistical analysis using Fishers Exact test.

Table 2: Distribution of FVL mutation among control and DS groups, with breakdown by CHD and hypothyroidism status.

FVL: Factor V Leiden, CHD: Congenital Heart Defect

The table presents the total number of individuals (N), FVL-positive (FVL+), FVL-negative (FVL−), and genotype combinations (FVL+/FVL+ and FVL+/FVL−) for each group.

* There was a significantly higher phenotypic and allelic frequency of FVL in DS children with CHD (p-value=0.037 and 0.02) compared to controls.

** There was a significantly higher phenotypic and allelic frequency of FVL in DS children with both CHD and hypothyroidism (p- value=0.013and 0.020) compared to controls.

1. Grimm J, Heckl D, Klusmann J.H (2021) Molecular mechanisms of the genetic predisposition to acute megakaryoblastic leukemia in infants with Down syndrome. Front Oncol. 11: 636633.
2. Zhang R, Yin Y, Zhang S, Chen L, Pu L, et al. (2019) Application of differentially methylated loci in clinical diagnosis of trisomy 21 syndrome. Genet Test Mol Biomarkers. 23(4): 246–250.
3. Ho WK, Hankey GJ, Quinlan DJ, Eikelboom JW (2006) Risk of recurrent venous thromboembolism in patients with common thrombophilia: a systematic review. Arch Intern Med. 166(7): 729–36.
4. Larson A, Rinaldo L, Lanzino G, and Klaas J.P (2020) High prevalence of pro-thrombotic conditions in adult patients with moyamoya disease and moyamoya syndrome: a single center study. Acta Neurochir. 162(8): 1853–1859.
5. Corral J, Roldán V, and Vicente V (2010) Deep venous thrombosis or pulmonary embolism and factor V Leiden: enigma or paradox. Haematologica. 95(6): 863.
6. Saeed A, Sumreen, Kashif M.A (2015) To determine the frequency of Factor V Leiden in cases of deep vein thrombosis and healthy controls. Pak. J. Med. Sci. 31(5): 1219-22.
7. Mukesh S, and Wei Li (2019) Factor V Leiden and the risk of pulmonary embolism. Cardiol. Cardiovasc. Med. 3: 1–8.
8. Bergström S, Carr H, Petersson G, Stephansson O, Bonamy A.K, et al. (2016) Trends in congenital heart defects in infants with Down syndrome. Pediatrics. 138(1): e20160123.
9. Jensen AS, Idorn L, Thomsen C, von der Recke P, et al. (2015) Prevalence of cerebral and pulmonary thrombosis in patients with cyanotic congenital heart disease. Heart. 101(19): 1540–1546.
10. Abdelghani E, Cua C.L, Giver J, Rodriguez V (2021) Thrombosis prevention and anticoagulation management in the pediatric patient with congenital heart disease. Cardiol. Ther. 10(2): 325– 348.
11. Silvey M, Brandão L.R (2017) Risk factors, prophylaxis, and treatment of venous thromboembolism in congenital heart disease patients. Front. Pediatr. 5: 146.
12. Mandalenakis Z, Rosengren A, Lappas G, Eriksson P, Hansson P.O, et al. (2016) Ischemic stroke in children and young adults with congenital heart disease. J. Am. Heart Assoc. 5(2): e003071.
13. Green R.C, Berg J.S, Grody W.W, Kalia S.S, Korf B.R, et al. (2013) ACMG recommendations for reporting of incidental findings in clinical exome and genome sequencing. Genet. Med. 15(7): 565–574.
14. Gudmundsson S, Singer-Berk M, Watts N.A, Phu W, Goodrich J.K, et al. (2022) Variant interpretation using population databases: lessons from gnomAD. Hum. Mutat. 43(8): 1012– 1030.
15. Gohil R, Peck G, Sharma P (2009) The genetics of venous thromboembolism: a meta-analysis involving approximately 120,000 cases and 180,000 controls. Thromb Haemost. 102(2): 360.
16. Segal J.B, Brotman D.J, Necochea A.J, Emadi A, Samal L, et al. (2009) Predictive value of factor V Leiden and prothrombin G20210A in adults with venous thromboembolism and in family members of those with a mutation: a systematic review. JAMA. 301(23): 2472–2485.
17. Tsalta-Mladenov M, Levkova M, Andonova S (2022) Factor V Leiden, Factor II, Protein C, Protein S, and antithrombin and ischemic strokes in young adults: a meta-analysis. Genes. 13(11): 2081.
18. Damar İ.H, Eröz R, Kiliçaslan Ö (2021) Frequency of hereditary prothrombotic risk factors in patients with Down syndrome. Konuralp Med. J. 13(1): 89–93.